Taq DNA Polymerase Master Mix (Hot Start)
Code No. DTM-101 100 reactions [ 50 µL per reaction ]
Quick Taq™ HS DyeMix is a Taq-based 2x master mix PCR reagent that contains an electrophoresis dye (BPB; bromophenol blue) and anti-Taq antibodies for hot start PCR. This reagent contains all components for PCR except primers and template DNA. This reagent shows specific and efficient amplification. The amplified products can be directly loaded in the wells of agarose or acrylamide gels.
Store at -20ºC
This reagent includes the following components for 100 reactions, 50 µL total reaction volume:
2x Quick Taq™ HS DyeMix 1.25mL× 2
*In the case of the long-term storage (>3 months), this reagent should be stored at -20ºC.
Component | Volume | Final Concentration |
---|---|---|
Quick Taq™ HS DyeMix | 25 µL | 1x |
10pmol /µL Primer #1 | 1.0 µL | 0.2 µM |
10pmol /µL Primer #2 | 1.0 µL | 0.2 µM |
Template DNA | X µL | Genomic DNA ≤ 200 ng/50 µL Plasmid DNA ≤ 50 ng/50 µL Colony |
PCR grade water | Y µL | |
Total reaction volume | 50 µL |
* Do not use dNTPs from other kits or companies.
We recommend trying 3-step cycles when the Tm of primers is under 73ºC.
The human p53 genes (2.9 kb) was amplified using 50 ng of human genomic DNA. Quick Taq™ HS DyeMix successfully amplified the targets
M: 1 kb Ladder
1: Quick Taq™ HS DyeMix
2: rTaq DNA polymerase (hot start)
3: rTaq DNA polymerase
4: Taq Master Mix (Company A)
Template: Human genomic DNA 50 ng / 50 µL reaction
Forward Primer: AATGGATGATTTGATGCTGTCCC
Reverse Primer: ATAAGAGCTCCCAAGACTTAG
*Final concentration 0.2 µM
The inserts were amplified using Quick Taq™ HS DyeMix with universal primers from E. coli DH5α colonies bearing pTA2 plasmid (insert size: 500 bp). Quick Taq™ HS DyeMix successfully and efficiently amplified all targets.
M: 100 bp Ladder Markers
1: Colony (insert +)
2: Colony (insert -)
3: Colony (insert +)
4: Colony (insert +)
5: Colony (insert +)
N: Negative Control
M: 100 bp Ladder Marker
Forward Primer: CGCCAGGTTTTCCCAGTCACGAC
Reverse Primer: AGCGGATAACAATTTCACACAGGAAAC
*Final concentration 0.2 µM