PRINT

DESCRIPTION

Quick Taq® HS DyeMix is a Taq-based 2x master mix PCR reagent that contains an electrophoresis dye (BPB; bromophenol blue) and anti-Taq antibodies for hot start PCR. This reagent contains all components for PCR except primers and template DNA. This reagent shows specific and efficient amplification. The amplified products can be directly loaded in the wells of agarose or acrylamide gels.

FEATURES

  • Quick Taq® HS DyeMix contains bromophenol blue (BPB) as an electrophoresis dye; the PCR products can be analyzed directly with an agarose or acrylamide gel.
  • Enables greater PCR performance than conventional Taq DNA polymerase.
  • This reagent contains anti-Taq antibodies for hot start PCR. Hot start technology realizes highly specific and sensitive PCR.
  • Quick Taq® HS DyeMix is stable for at least three months at 4ºC. No decrease in reaction efficiency is observed following 30 freeze-thaw cycles.

APPLICATIONS

  • General PCR
  • Colony direct PCR

STORAGE CONDITION

Store at -20ºC

COMPONENTS

This reagent includes the following components for 100 reactions, 50 µl total reaction volume:

2x Quick Taq® HS DyeMix 1.25ml× 2

*In the case of the long-term storage (>3 months), this reagent should be stored at -20ºC.

TYPICAL PCR REACTION SETUP

Component Volume Final Concentration
Quick Taq® HS DyeMix 25 µl 1x
10pmol /µl Primer #1 1.0 µl 0.2 µM
10pmol /µl Primer #2 1.0 µl 0.2 µM
Template DNA X µl Genomic DNA ≤ 200 ng/50 µl
Plasmid DNA ≤ 50 ng/50 µl
Colony
PCR grade water Y µl
Total reaction volume 50 µl

* Do not use dNTPs from other kits or companies.

PCR CYCLE CONDITIONS

We recommend trying 3-step cycles when the Tm of primers is under 73ºC.

APPLICATION DATA

Example 1.Amplification of the human p53 genes (2.9 kb)

The human p53 genes (2.9 kb) was amplified using 50 ng of human genomic DNA. Quick Taq® HS DyeMix successfully amplified the targets

M: 1 kb Ladder
1: Quick Taq® HS DyeMix
2: rTaq DNA polymerase (hot start)
3: rTaq DNA polymerase
4: Taq Master Mix (Company A)

Template: Human genomic DNA 50 ng / 50 µl reaction
Forward Primer: AATGGATGATTTGATGCTGTCCC
Reverse Primer: ATAAGAGCTCCCAAGACTTAG
*Final concentration 0.2 µM

Example 2.Insert amplification by a colony-direct PCR

The inserts were amplified using Quick Taq® HS DyeMix with universal primers from E. coli DH5α colonies bearing pTA2 plasmid (insert size: 500 bp). Quick Taq® HS DyeMix successfully and efficiently amplified all targets.

M: 100 bp Ladder Markers
1: Colony (insert +)
2: Colony (insert -)
3: Colony (insert +)
4: Colony (insert +)
5: Colony (insert +)
N: Negative Control
M: 100 bp Ladder Marker

Forward Primer: CGCCAGGTTTTCCCAGTCACGAC
Reverse Primer: AGCGGATAACAATTTCACACAGGAAAC
*Final concentration 0.2 µM